Gene Editing Explained: CRISPR Treatment for Sickle Cell Disease
You may remember the 1997 movie GATTACA, the futuristic dystopia starring Ethan Hawk in a world where people’s genetics are designed, not inherited, and chronic disease is virtually extinct.
The movie began introducing us to this world “in a not-too-distant future”, and sure enough, thirty years after its release, scientists in China genetically modified three ‘designer babies’ to have an immunity to AIDS using CRISPR. The global controversy and backlash that ensued brought the debate about CRISPR’s capabilities to the forefront of the public imagination. But CRISPR’s reputation as the featured mad-scientist plaything may be up for a makeover in the coming weeks.
This year, the FDA might approve the first ever CRISPR-based treatment as soon as December 8. Exa-Cel, produced by Vertex Pharmaceuticals and CRISPR Therapeutics, is a gene therapy treatment for sickle cell disease. Sickle cell disease is a genetic condition, passed on from parent to child. Sickle Cell disease affects approximately 100,000 Americans. It predominantly impacts African Americans, affecting about 1 in 365 people according to the CDC.
To understand why CRISPR could be revolutionary for Sickle-cell patients, and the drug industry in general, let’s first take a look at how CRISPR actually works:
CRISPR is the nickname for CRISPR-CAS9. CAS9 is an enzyme that cuts DNA. Enzymes are special proteins that exist almost everywhere in your body, and in nature. They are used to break down molecules and catalyze chemical reactions. Enzymes are what help you digest your food and turn calories into energy for your body to use. Enzymes are the main ingredient in the meat tenderizer at your local supermarket, and the reason why your tongue itches if you eat too much pineapple.
CRISPR refers to the DNA that is broken down by the CAS9 enzyme. CRISPR is an acronym for “Clusters of Regularly Interspaced Short Palindromic Repeats”. Let’s make like an enzyme and break this up into more manageable pieces:
A palindrome is a series of letters that are the same when read forward or backward. In English, this would be words like “racecar” and “kayak” and, and phrases like “Madam I’m Adam”.
In DNA, a palindrome might look like this:
GTCATTCACCAGTCATTC OR GTCATTCTAGGATGTCATTC
For CAS9, it’s like waving a red flag that says “Cut here! Cut here!”
So, a CRISPR DNA strand has many of these palindromes repeated, which means CRISPR-CAS9 has to cut the DNA in multiple places. More importantly, they are interspaced between important genes, or segments of genetic code that perform specific tasks in the body.
Why does it do this?
CRISPR-CAS9 was originally discovered in the bacteria Streptococcus thermophilus (the same type of bacteria found in cheese and yogurt). We now know that CRISPR-CAS9 is common in many species of bacteria and archaea. CRISPR-CAS9 is very good at recognizing foreign DNA (e.g. from an infectious phage, or virus), and cutting it into tiny pieces as a defense mechanism.
We can use CRISPR-CAS9 to strategically cut DNA from other organisms, including humans. Because of the ‘palindromic repeats’, CRISPR-CAS9 cuts DNA in the same pattern every time. CAS-9 always cuts DNA strands in a ‘zigzag’. Just like factory grade puzzle pieces, any other piece of DNA cut by CRISPR-CAS-9 can be inserted into the spaces we made. CRISPR-CAS9 helps us to control how DNA is cut so we can insert new genes into the spaces.
Now let’s look at how CRISPR-CAS9 could be used to treat sickle cell disease:
Sickle cell disease (SCD), or sickle cell anemia, is a chronic disease that causes red blood cells in the body to be mal-formed into sickle-like shapes. Normal red blood cells are a rounded shape that is ideal for carrying oxygen from the lungs to the rest of your body, and carbon dioxide waste back to the lungs for you to breathe out. The sickle-shaped cells are not as adept at carrying oxygen. This creates a host of complications. Sickle cells clog blood vessels and can cause organ decline and eventually organ failure over time.
What causes the sickle cell shapes? DNA.
Your DNA contains the instructions your body needs to build a healthy red blood cell. Your DNA is also making thousands of copies of itself as your cells divide and grow. It’s an efficient system, but sometimes the DNA copies can contain errors we call mutations. In this case, a slight change in instructions might create a different shape for your red blood cells. Some mutations are helpful, and help your body have an advantage over those without the mutation.
In fact, people who have some sickle-shaped blood cells, but not all, in the blood stream have a natural protection against malaria. The problem happens when a child inherits the sickle cell trait from both parents. Too much of a good thing causes more harm than good.
Until now, the best treatment option for sickle cell patients has been via bone marrow transplants, but this can be extremely risky. If the transplanted cells aren’t a close enough match, the patient’s immune system will see them as a threat, rejecting them.
That’s where CRISPR-CAS9 comes in. CRISPR lets us use the patient’s own bone marrow cells for the ‘transplant’, ensuring a perfect match every time. By cutting out the sickle cell gene and replacing it with a gene for producing normal red blood cells, the body of a sickle-cell patient now has the instructions it needs to produce healthy red blood cells.
The CRISPR treatment for sickle cell disease is specifically designed not to be passed down to the patient’s offspring. CRISPR modifies the bone marrow cells outside of the body before being ‘transplanted’. The healthy red blood cells are produced and populate the bloodstream, but other parts of the body, including egg and sperm cells still contain the original genome.
It’s important to keep in mind that genetic modification is not new or futuristic. Many of the foods you see in the supermarket are genetically modified. As early as the 1800’s, scientists experimented with selectively breeding vegetables for desired traits, creating broccoli, cabbage, and cauliflower from wild mustard. In the later 20th century, we realized we could get these traits in only one to two generations by working with DNA directly. Grains such as corn and wheat have been genetically modified to be resistant to pests, and tomatoes have been genetically modified to have a longer shelf life and better resistance to cold. There are many different types of methods for genetic modification, but CRISPR is the newest and most efficient.
CRISPR is a tool we may be able to use to speed up how our bodies heal and interact with our environment, no more natural or unnatural than taking a drug or other more conventional medication. The difference in these tools is scale. Instead of targeting activity in organs and tissue, CRISPR directly targets the activity in DNA. But, like any technology, we need to be mindful of using it ethically and minimizing costs to benefits.
It may be one day, that CRISPR-based treatments will be used for fertility issues, type-1 diabetes, muscular dystrophy, and other common genetic disorders. The FDA decision on December 8 may just open the doors to our ‘not-too-distant-future’ in medicine.
Further Reading:
https://www.broadinstitute.org/what-broad/areas-focus/project-spotlight/crispr-timeline
https://www.genome.gov/genetics-glossary/CRISPR
https://www.yourgenome.org/facts/what-is-crispr-cas9/
https://www.cdc.gov/ncbddd/sicklecell/facts.html
https://www.weforum.org/agenda/2023/02/crispr-gene-editing-better-world/
https://www.biopharmadive.com/news/sickle-cell-crispr-gene-editing-vertex-exa-cel-barriers/698121/





